ID: 1070279456_1070279460

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1070279456 1070279460
Species Human (GRCh38) Human (GRCh38)
Location 10:75038051-75038073 10:75038072-75038094
Sequence CCATGACGCAGTGAACCAGGATC TCTTACCTGCAGATGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141} {0: 1, 1: 0, 2: 3, 3: 12, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!