ID: 1070286076_1070286083

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1070286076 1070286083
Species Human (GRCh38) Human (GRCh38)
Location 10:75084941-75084963 10:75084976-75084998
Sequence CCACCCTCCCAGCAGAGCTGCGC CCTTCCCACTTTGACACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!