ID: 1070305173_1070305179

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1070305173 1070305179
Species Human (GRCh38) Human (GRCh38)
Location 10:75235273-75235295 10:75235300-75235322
Sequence CCAGCGCCTTCTTGGCCTGGATG GCGCCAGGTTGGCCAAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 167} {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!