ID: 1070321164_1070321172

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1070321164 1070321172
Species Human (GRCh38) Human (GRCh38)
Location 10:75355729-75355751 10:75355776-75355798
Sequence CCCCAAATTTAGTGGTGTAAAAC CTATGGGTCTGGAATTCAGATGG
Strand - +
Off-target summary {0: 1, 1: 26, 2: 200, 3: 889, 4: 2437} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!