ID: 1070329118_1070329142

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1070329118 1070329142
Species Human (GRCh38) Human (GRCh38)
Location 10:75405464-75405486 10:75405515-75405537
Sequence CCCCCGGGGGCCTCCCCACCCCT GCGGGGAGAGAAAGCGCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 556} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!