ID: 1070329125_1070329144

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1070329125 1070329144
Species Human (GRCh38) Human (GRCh38)
Location 10:75405479-75405501 10:75405532-75405554
Sequence CCACCCCTGTCCTGCCCCGCCTC GCGCGGAGGCCTCTGCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 171, 4: 1514} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!