ID: 1070379306_1070379311

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1070379306 1070379311
Species Human (GRCh38) Human (GRCh38)
Location 10:75866252-75866274 10:75866274-75866296
Sequence CCACCTCTGCTCCACACAGCACA AGAATTGTGGCACAGCAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!