ID: 1070380747_1070380754

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1070380747 1070380754
Species Human (GRCh38) Human (GRCh38)
Location 10:75878458-75878480 10:75878488-75878510
Sequence CCCTGACTGAATTCTGCGTCATC AAAGGCCTTGTGGTGTCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!