ID: 1070570725_1070570731

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1070570725 1070570731
Species Human (GRCh38) Human (GRCh38)
Location 10:77637963-77637985 10:77637979-77638001
Sequence CCGCGGGCCGCCCGCGCCCGGGG CCCGGGGTCTGCGCCGCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 479} {0: 1, 1: 0, 2: 5, 3: 28, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!