ID: 1070570725_1070570747

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1070570725 1070570747
Species Human (GRCh38) Human (GRCh38)
Location 10:77637963-77637985 10:77638009-77638031
Sequence CCGCGGGCCGCCCGCGCCCGGGG CCGGCTCCGCGCGCGGTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 479} {0: 1, 1: 0, 2: 1, 3: 23, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!