ID: 1070588128_1070588129

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1070588128 1070588129
Species Human (GRCh38) Human (GRCh38)
Location 10:77781466-77781488 10:77781481-77781503
Sequence CCATGCAGCATCTTGGCCTCCAA GCCTCCAAGCACATCACCCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 19, 4: 204} {0: 1, 1: 0, 2: 1, 3: 17, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!