ID: 1070592634_1070592644

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1070592634 1070592644
Species Human (GRCh38) Human (GRCh38)
Location 10:77811659-77811681 10:77811683-77811705
Sequence CCCGGGGCCACAACTCCTGGCTA CATGGGCCCCTGCTGGTCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!