ID: 1070610039_1070610050

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1070610039 1070610050
Species Human (GRCh38) Human (GRCh38)
Location 10:77926702-77926724 10:77926734-77926756
Sequence CCGCCTCCCGGGCTCCGGAGCGC GGCTGCCGCGGCGGCGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 339} {0: 1, 1: 1, 2: 4, 3: 91, 4: 848}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!