ID: 1070617494_1070617496

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1070617494 1070617496
Species Human (GRCh38) Human (GRCh38)
Location 10:77980046-77980068 10:77980063-77980085
Sequence CCACTCAGTTTTTTTCATTCCCT TTCCCTTGGAAGCCTAGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 639} {0: 1, 1: 0, 2: 0, 3: 12, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!