ID: 1070626466_1070626476

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1070626466 1070626476
Species Human (GRCh38) Human (GRCh38)
Location 10:78054514-78054536 10:78054543-78054565
Sequence CCTTCCCGCTTTTGCAGATGAGG GGGCTTGGAGTGCAAGCATTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 69, 4: 439} {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!