ID: 1070699312_1070699316

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1070699312 1070699316
Species Human (GRCh38) Human (GRCh38)
Location 10:78588167-78588189 10:78588182-78588204
Sequence CCAGCCTGAAGCATTTTTGGAGC TTTGGAGCCCAGAGGGAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 33, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!