ID: 1070702211_1070702220

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1070702211 1070702220
Species Human (GRCh38) Human (GRCh38)
Location 10:78612473-78612495 10:78612499-78612521
Sequence CCCCAACTGCCCTTGAAATATGG GACACAGAGGTGGCTCTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148} {0: 1, 1: 0, 2: 1, 3: 32, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!