ID: 1070741583_1070741590

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1070741583 1070741590
Species Human (GRCh38) Human (GRCh38)
Location 10:78907048-78907070 10:78907061-78907083
Sequence CCTGTCCCCTTCCCTCCACACAG CTCCACACAGCCACCATCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 25, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!