ID: 1070746120_1070746125

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1070746120 1070746125
Species Human (GRCh38) Human (GRCh38)
Location 10:78935011-78935033 10:78935024-78935046
Sequence CCATCCATGTGATCCTGATGGGC CCTGATGGGCTCTGGAGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 307} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!