ID: 1070770038_1070770047

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1070770038 1070770047
Species Human (GRCh38) Human (GRCh38)
Location 10:79076984-79077006 10:79077028-79077050
Sequence CCTTTGCAGAGCAAATGACCCAC TCCTCTGTGTATGGGGAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!