ID: 1070792103_1070792108

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1070792103 1070792108
Species Human (GRCh38) Human (GRCh38)
Location 10:79195648-79195670 10:79195672-79195694
Sequence CCCAAAGGTGGCCGGTGTGCAGG AGCCCAGTGATGTAAGTGACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!