ID: 1070795234_1070795239

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1070795234 1070795239
Species Human (GRCh38) Human (GRCh38)
Location 10:79212444-79212466 10:79212472-79212494
Sequence CCACTGGCCTACACCATCACACC AAAAAATTTTTTGCACAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 168, 4: 1388} {0: 1, 1: 3, 2: 141, 3: 1089, 4: 4039}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!