ID: 1070812727_1070812730

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1070812727 1070812730
Species Human (GRCh38) Human (GRCh38)
Location 10:79306395-79306417 10:79306411-79306433
Sequence CCTGCAGAGGCACAGAATTTCTG ATTTCTGTGCTGATGGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 215} {0: 1, 1: 0, 2: 1, 3: 14, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!