ID: 1070826787_1070826794

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1070826787 1070826794
Species Human (GRCh38) Human (GRCh38)
Location 10:79394899-79394921 10:79394925-79394947
Sequence CCCCTACTAGGAGGCAATCTAAA CCTCACACCACTCCAAAGGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!