ID: 1070828978_1070828989

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1070828978 1070828989
Species Human (GRCh38) Human (GRCh38)
Location 10:79407215-79407237 10:79407245-79407267
Sequence CCAGGTGCAGACCTGCCCCCAGG TGTCCCAGAGGAGCACTCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 411} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!