ID: 1070864708_1070864724

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1070864708 1070864724
Species Human (GRCh38) Human (GRCh38)
Location 10:79700837-79700859 10:79700881-79700903
Sequence CCCGCCCTAGGAGGGCCCCGCTG GCGGCACCTGGGTGCTTCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!