ID: 1070878419_1070878427

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1070878419 1070878427
Species Human (GRCh38) Human (GRCh38)
Location 10:79838610-79838632 10:79838654-79838676
Sequence CCTGGGCATCCCGCAGGGCCCCC TCCGCCTTGAGCACAGCCACAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 4, 3: 25, 4: 359} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!