ID: 1070878497_1070878511

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1070878497 1070878511
Species Human (GRCh38) Human (GRCh38)
Location 10:79838969-79838991 10:79839010-79839032
Sequence CCCTAGGAGGGCCCCGCTGGAGA CGGCACCTGGGTGCTTCCTGGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 3, 3: 12, 4: 103} {0: 2, 1: 2, 2: 2, 3: 9, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!