ID: 1070883047_1070883055

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1070883047 1070883055
Species Human (GRCh38) Human (GRCh38)
Location 10:79866035-79866057 10:79866079-79866101
Sequence CCCAGCAACTTCCAGATGTTGAG TCTGCTCCAAATGAATACCCTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 19, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!