ID: 1070935551_1070935556

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1070935551 1070935556
Species Human (GRCh38) Human (GRCh38)
Location 10:80291982-80292004 10:80292013-80292035
Sequence CCTTATGTTTTTTTATTGGGGGG TCTCACTCTGTCACCCAGGCTGG
Strand - +
Off-target summary No data {0: 30388, 1: 79844, 2: 153170, 3: 168549, 4: 152343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!