ID: 1070949346_1070949355

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1070949346 1070949355
Species Human (GRCh38) Human (GRCh38)
Location 10:80418554-80418576 10:80418587-80418609
Sequence CCGGCCAAGTCCTGCAAGGGAGA AGGTTCGATGGGCTGGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 187} {0: 1, 1: 0, 2: 1, 3: 24, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!