ID: 1070956474_1070956478

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1070956474 1070956478
Species Human (GRCh38) Human (GRCh38)
Location 10:80466973-80466995 10:80467014-80467036
Sequence CCAAAAATTTAGAGTCAGCAGAA AAGTCCGTTAACCAATACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 7, 3: 12, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!