ID: 1071055684_1071055700

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1071055684 1071055700
Species Human (GRCh38) Human (GRCh38)
Location 10:81505907-81505929 10:81505947-81505969
Sequence CCCCGTGCTCAGAGCGGCCAGCC CAGTGAGGGGCTTAGCACCTGGG
Strand - +
Off-target summary No data {0: 394, 1: 579, 2: 635, 3: 434, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!