ID: 1071087079_1071087085

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1071087079 1071087085
Species Human (GRCh38) Human (GRCh38)
Location 10:81876234-81876256 10:81876259-81876281
Sequence CCTCGCCGCCTGTTTTCTAGCAA CCCCTCCCCCATCCCAGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 249} {0: 1, 1: 0, 2: 7, 3: 71, 4: 602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!