ID: 1071145494_1071145499

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1071145494 1071145499
Species Human (GRCh38) Human (GRCh38)
Location 10:82565490-82565512 10:82565527-82565549
Sequence CCTTCAATCCCCACCAAACACAC ATAGATAAGCCAGTCTCCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!