ID: 1071180545_1071180549

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1071180545 1071180549
Species Human (GRCh38) Human (GRCh38)
Location 10:82978727-82978749 10:82978747-82978769
Sequence CCAGGAACTTCCCTTTTTCTCAG CAGTGTCTCCAAAGGTAAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 44, 4: 644}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!