ID: 1071283285_1071283288

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1071283285 1071283288
Species Human (GRCh38) Human (GRCh38)
Location 10:84122621-84122643 10:84122641-84122663
Sequence CCTGAAGGGAGTTTCTCCTAGGT GGTCTGGTCAGACCTTTGTATGG
Strand - +
Off-target summary No data {0: 40, 1: 82, 2: 96, 3: 77, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!