ID: 1071283287_1071283290

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1071283287 1071283290
Species Human (GRCh38) Human (GRCh38)
Location 10:84122637-84122659 10:84122668-84122690
Sequence CCTAGGTCTGGTCAGACCTTTGT TAATTAAGATTTAGATCCCCTGG
Strand - +
Off-target summary {0: 36, 1: 91, 2: 103, 3: 63, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!