ID: 1071381580_1071381585

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1071381580 1071381585
Species Human (GRCh38) Human (GRCh38)
Location 10:85068572-85068594 10:85068591-85068613
Sequence CCTCAAGTCTATGAATGCTGAGG GAGGGAGGTGAGGATGCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 29, 3: 138, 4: 800}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!