ID: 1071469648_1071469653

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1071469648 1071469653
Species Human (GRCh38) Human (GRCh38)
Location 10:85974670-85974692 10:85974701-85974723
Sequence CCCTCTTGACTTTCTGCAACCAG CCACCACTTTTCATGGATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 751} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!