ID: 1071472554_1071472561

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1071472554 1071472561
Species Human (GRCh38) Human (GRCh38)
Location 10:85994068-85994090 10:85994117-85994139
Sequence CCAGCTAATCAAACATGTCCTGG TTTCAAACACACCAAACAACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 79} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!