ID: 1071542237_1071542242

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1071542237 1071542242
Species Human (GRCh38) Human (GRCh38)
Location 10:86496520-86496542 10:86496560-86496582
Sequence CCAAAAGGTAAAAACAATCCAAG ATGGATAAACAAAATGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 133, 3: 660, 4: 2100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!