ID: 1071542240_1071542242

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1071542240 1071542242
Species Human (GRCh38) Human (GRCh38)
Location 10:86496546-86496568 10:86496560-86496582
Sequence CCATCAACAGATGAATGGATAAA ATGGATAAACAAAATGTGGAAGG
Strand - +
Off-target summary {0: 971, 1: 2576, 2: 4620, 3: 7496, 4: 10634} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!