ID: 1071549691_1071549704

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1071549691 1071549704
Species Human (GRCh38) Human (GRCh38)
Location 10:86557127-86557149 10:86557173-86557195
Sequence CCAGGGAGCGTGCACTCACCTGC CAGGGGAAGCCAGAGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 113, 4: 1085}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!