ID: 1071563076_1071563086

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1071563076 1071563086
Species Human (GRCh38) Human (GRCh38)
Location 10:86658092-86658114 10:86658135-86658157
Sequence CCTCATGTCCTTCACCCAGGCCC CTCTATAAGCAGTGGCTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 404} {0: 1, 1: 0, 2: 1, 3: 16, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!