ID: 1071568673_1071568679

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1071568673 1071568679
Species Human (GRCh38) Human (GRCh38)
Location 10:86684693-86684715 10:86684722-86684744
Sequence CCAGGGCCAGGCTGGCCGGGGCC CCCCCAGCTACAGCCCACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 98, 4: 731} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!