ID: 1071573048_1071573060

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1071573048 1071573060
Species Human (GRCh38) Human (GRCh38)
Location 10:86708445-86708467 10:86708490-86708512
Sequence CCCAGTGCCAGTCCCTGACTCAG GGCAAAGTGTCCTCCAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!