ID: 1071626806_1071626809

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1071626806 1071626809
Species Human (GRCh38) Human (GRCh38)
Location 10:87180185-87180207 10:87180202-87180224
Sequence CCCAACATCGTATATACTGGTTG TGGTTGTGCAAAATGTGGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 2, 4: 81} {0: 1, 1: 2, 2: 3, 3: 15, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!