ID: 1071639129_1071639135

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1071639129 1071639135
Species Human (GRCh38) Human (GRCh38)
Location 10:87288266-87288288 10:87288296-87288318
Sequence CCCAATTGCAGCTGAGGAAACAG GAGGCCAAGCAGCTGGCCCAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 9, 3: 185, 4: 1481} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!