ID: 1071683747_1071683757

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1071683747 1071683757
Species Human (GRCh38) Human (GRCh38)
Location 10:87733841-87733863 10:87733893-87733915
Sequence CCTGTTCCCCCTACTATGTCTCC GGTGGCCTGTGACCAAAACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!